Il2rg cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Il2rg cDNA ORF Clone, Rat, untagged

Il2rg cDNA ORF Clone, Rat, untagged

SPD-07957

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 2 receptor, gamma.
Target Information
Species Rat
Target Name IL-2 Receptor
Gene Abbr. Il2rg
Gene ID 140924
Full Name interleukin 2 receptor subunit gamma
Alias Ab2-183, Cd132
Introduction The Common gamma Chain, also known as CD132, is a transmembrane protein belonging to the hematopoietin receptor family. gamma c is a signaling component of the functional receptor complexes for IL-2, IL-4, IL-7, IL-9, and IL-15.
Product Details
Description Full length Clone DNA of Rat interleukin 2 receptor, gamma.
NCBI Ref Seq NM_080889.1
RefSeq ORF Size 1107 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.