IL2RB cDNA ORF Clone, Rhesus, C-His tag - CD BioSciences

service-banner

IL2RB cDNA ORF Clone, Rhesus, C-His tag

IL2RB cDNA ORF Clone, Rhesus, C-His tag

SPD-07879

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus interleukin 2 receptor, beta with C terminal His tag.
Target Information
Species Rhesus
Target Name IL-2 Receptor
Gene Abbr. IL2RB
Gene ID 696331
Full Name interleukin 2 receptor subunit beta
Introduction The Interleukin 2 Receptor alpha and beta chains, together with the common gamma chain, constitute the high affinity IL2 receptor present on activated T and B cells, thymocyte subset, pre B cells and T regulatory cells. Homodimeric alpha chains result in low affinity receptor, while homodimeric beta chains produce a medium affinity receptor. Normally an integral membrane protein, soluble IL2 Receptor alpha has been isolated and determined to result from extracellular proteolyisis. Alternately spliced IL2 Receptor alpha mRNAs have been isolated, but the significance of each is presently unknown.
Product Details
Description Full length Clone DNA of Rhesus interleukin 2 receptor, beta with C terminal His tag.
NCBI Ref Seq XM_002798371.1
RefSeq ORF Size 1656 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.