Online Inquiry
Il2rb cDNA ORF Clone, Mouse, untagged
SPD-07917
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 2 receptor, beta chain. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-2 Receptor |
Gene Abbr. | Il2rb |
Gene ID | 16185 |
Full Name | interleukin 2 receptor, beta chain |
Alias | CD122, IL-15R, IL-15Rbeta, IL15R, IL15Rbeta |
Introduction | The Interleukin 2 Receptor alpha and beta chains, together with the common gamma chain, constitute the high affinity IL2 receptor present on activated T and B cells, thymocyte subset, pre B cells and T regulatory cells. Homodimeric alpha chains result in low affinity receptor, while homodimeric beta chains produce a medium affinity receptor. Normally an integral membrane protein, soluble IL2 Receptor alpha has been isolated and determined to result from extracellular proteolyisis. Alternately spliced IL2 Receptor alpha mRNAs have been isolated, but the significance of each is presently unknown. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 2 receptor, beta chain. |
NCBI Ref Seq | NM_008368.3 |
RefSeq ORF Size | 1620 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | HindIII + XbaI (6.1kb + 1.62kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.