IL2RB cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

IL2RB cDNA ORF Clone, Human, C-Myc tag

IL2RB cDNA ORF Clone, Human, C-Myc tag

SPD-07920

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 2 receptor, beta with C terminal Myc tag.
Target Information
Species Human
Target Name IL-2 Receptor
Gene Abbr. IL2RB
Gene ID 3560
Full Name interleukin 2 receptor subunit beta
Alias CD122, IL15RB, IMD63, P70-75
Introduction The Interleukin 2 Receptor alpha and beta chains, together with the common gamma chain, constitute the high affinity IL2 receptor present on activated T and B cells, thymocyte subset, pre B cells and T regulatory cells. Homodimeric alpha chains result in low affinity receptor, while homodimeric beta chains produce a medium affinity receptor. Normally an integral membrane protein, soluble IL2 Receptor alpha has been isolated and determined to result from extracellular proteolyisis. Alternately spliced IL2 Receptor alpha mRNAs have been isolated, but the significance of each is presently unknown.
Product Details
Description Full length Clone DNA of Human interleukin 2 receptor, beta with C terminal Myc tag.
NCBI Ref Seq NM_000878.4
RefSeq ORF Size 1701 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.7kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.