IL2RA cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

IL2RA cDNA ORF Clone, Human, C-HA tag

IL2RA cDNA ORF Clone, Human, C-HA tag

SPD-07871

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 2 receptor, alpha (IL2RA) with C terminal HA tag.
Target Information
Species Human
Target Name IL-2 Receptor
Gene Abbr. IL2RA
Gene ID 3559
Full Name interleukin 2 receptor subunit alpha
Alias CD25, IDDM10, IL2R, IMD41, TCGFR
Introduction The Interleukin 2 Receptor alpha and beta chains, together with the common gamma chain, constitute the high affinity IL2 receptor present on activated T and B cells, thymocyte subset, pre B cells and T regulatory cells. Homodimeric alpha chains result in low affinity receptor, while homodimeric beta chains produce a medium affinity receptor. Normally an integral membrane protein, soluble IL2 Receptor alpha has been isolated and determined to result from extracellular proteolyisis. Alternately spliced IL2 Receptor alpha mRNAs have been isolated, but the significance of each is presently unknown.
Product Details
Description Full length Clone DNA of Human interleukin 2 receptor, alpha (IL2RA) with C terminal HA tag.
NCBI Ref Seq NM_000417.1
RefSeq ORF Size 819 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.