IL27RA cDNA ORF Clone, Rhesus, N-HA tag - CD BioSciences

service-banner

IL27RA cDNA ORF Clone, Rhesus, N-HA tag

IL27RA cDNA ORF Clone, Rhesus, N-HA tag

SPD-08194

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus interleukin 27 receptor, alpha with N terminal HA tag.
Target Information
Species Rhesus
Target Name IL-27 Receptor
Gene Abbr. IL27RA
Gene ID 717549
Full Name interleukin 27 receptor subunit alpha
Introduction The IL-27 Receptor complex includes WSX-1 and gp130. IL-27R (WSX-1) is 65-70 kDa protein and is highly expressed in lymphoid tissues such as spleen, lymph nodes and peripheral blood leukocytes including CD4+ and CD8+ T cells, monocytes, DCs and NK cells. IL-27R activation includes STAT1, STAT3, STAT4 and STAT5, leading to differing pathway dependent effector activities. Like the IL12/IL-12R complex, the IL-27/IL-27R complex also has Th1 enhancing activity especially enhancement of IFNg production by naive T cells and NK cells. IL-27R mediates downregulation of Th2 activity by findings that IL-27R deficiencies mitigate inflammatory pathology in helminthic infections in mice. The possibility of utilizing IL-27R as a target for autoimmune inflammatory diseases, especially of mucosal surfaces as in human IBD, is under investigation, measured by Th2 type cytokines and bolstered through Th2
Product Details
Description Full length Clone DNA of Rhesus interleukin 27 receptor, alpha with N terminal HA tag.
NCBI Ref Seq XM_001111176.2
RefSeq ORF Size 1911 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.