Online Inquiry
IL27RA cDNA ORF Clone, Human, N-Myc tag
SPD-08183
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 27 receptor, alpha with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-27 Receptor |
Gene Abbr. | IL27RA |
Gene ID | 9466 |
Full Name | interleukin 27 receptor subunit alpha |
Alias | CRL1, IL-27RA, IL27R, TCCR, WSX1 |
Introduction | The IL-27 Receptor complex includes WSX-1 and gp130. IL-27R (WSX-1) is 65-70 kDa protein and is highly expressed in lymphoid tissues such as spleen, lymph nodes and peripheral blood leukocytes including CD4+ and CD8+ T cells, monocytes, DCs and NK cells. IL-27R activation includes STAT1, STAT3, STAT4 and STAT5, leading to differing pathway dependent effector activities. Like the IL12/IL-12R complex, the IL-27/IL-27R complex also has Th1 enhancing activity especially enhancement of IFNg production by naive T cells and NK cells. IL-27R mediates downregulation of Th2 activity by findings that IL-27R deficiencies mitigate inflammatory pathology in helminthic infections in mice. The possibility of utilizing IL-27R as a target for autoimmune inflammatory diseases, especially of mucosal surfaces as in human IBD, is under investigation, measured by Th2 type cytokines and bolstered through Th2 |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 27 receptor, alpha with N terminal Myc tag. |
NCBI Ref Seq | NM_004843.2 |
RefSeq ORF Size | 1911 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.