IL27RA cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

IL27RA cDNA ORF Clone, Human, N-His tag

IL27RA cDNA ORF Clone, Human, N-His tag

SPD-08182

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 27 receptor, alpha with N terminal His tag.
Target Information
Species Human
Target Name IL-27 Receptor
Gene Abbr. IL27RA
Gene ID 9466
Full Name interleukin 27 receptor subunit alpha
Alias CRL1, IL-27RA, IL27R, TCCR, WSX1
Introduction The IL-27 Receptor complex includes WSX-1 and gp130. IL-27R (WSX-1) is 65-70 kDa protein and is highly expressed in lymphoid tissues such as spleen, lymph nodes and peripheral blood leukocytes including CD4+ and CD8+ T cells, monocytes, DCs and NK cells. IL-27R activation includes STAT1, STAT3, STAT4 and STAT5, leading to differing pathway dependent effector activities. Like the IL12/IL-12R complex, the IL-27/IL-27R complex also has Th1 enhancing activity especially enhancement of IFNg production by naive T cells and NK cells. IL-27R mediates downregulation of Th2 activity by findings that IL-27R deficiencies mitigate inflammatory pathology in helminthic infections in mice. The possibility of utilizing IL-27R as a target for autoimmune inflammatory diseases, especially of mucosal surfaces as in human IBD, is under investigation, measured by Th2 type cytokines and bolstered through Th2
Product Details
Description Full length Clone DNA of Human interleukin 27 receptor, alpha with N terminal His tag.
NCBI Ref Seq NM_004843.2
RefSeq ORF Size 1908 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 1.91kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.