Il27 cDNA ORF Clone, Rat, C-His tag - CD BioSciences

service-banner

Il27 cDNA ORF Clone, Rat, C-His tag

Il27 cDNA ORF Clone, Rat, C-His tag

SPD-08147

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 27 with C terminal His tag.
Target Information
Species Rat
Target Name IL-27
Gene Abbr. Il27
Gene ID 365368
Full Name interleukin 27
Alias RGD1561420
Introduction The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rat interleukin 27 with C terminal His tag.
NCBI Ref Seq XM_344962.4
RefSeq ORF Size 705 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.