IL27 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

IL27 cDNA ORF Clone, Human, N-HA tag

IL27 cDNA ORF Clone, Human, N-HA tag

SPD-08174

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 27 with N terminal HA tag.
Target Information
Species Human
Target Name IL-27
Gene Abbr. IL27
Gene ID 246778
Full Name interleukin 27
Alias IL-27, IL-27A, IL27A, IL27p28, IL30
Introduction The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human interleukin 27 with N terminal HA tag.
NCBI Ref Seq NM_145659.3
RefSeq ORF Size 732 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 0.74kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.