Online Inquiry
IL27 cDNA ORF Clone, Human, C-FLAG tag
SPD-08166
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human interleukin 27 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | IL-27 |
| Gene Abbr. | IL27 |
| Gene ID | 246778 |
| Full Name | interleukin 27 |
| Alias | IL-27, IL-27A, IL27A, IL27p28, IL30 |
| Introduction | The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human interleukin 27 with C terminal Flag tag. |
| NCBI Ref Seq | NM_145659.3 |
| RefSeq ORF Size | 732 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 0.77kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.