Online Inquiry
Il25 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-08136
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 25 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-25 |
Gene Abbr. | Il25 |
Gene ID | 140806 |
Full Name | interleukin 25 |
Alias | IL-1, IL-17e, Il1, Il17e |
Introduction | A number of cytokines belonging to the interleukin (IL)-17 family have been identified, termed IL-17A-F. IL-17 is a potent proinflammatory cytokine that plays roles in a number of diseases including rheumatoid arthritis, multiple sclerosis, and promotion of tumor growth. IL-17E, C, and B are able to induce proinflammatory responses. However, they do not bind to the IL-17 receptor suggesting that an additional IL-17R related receptor may exist. Receptors for IL-17B and IL-17E have been independently isolated by Shi, et al and Lee, et al. and have been designated as EV127 (in mouse) and IL-17Rh1 (in human), respectively. IL-17E, also called IL-25, induces activation of NF-kB pathway and like IL-17 also induces production of IL-8. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 25 with C terminal Flag tag. |
NCBI Ref Seq | NM_080729.2 |
RefSeq ORF Size | 510 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 0.56kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.