IL25 cDNA ORF Clone, Canine, C-Myc tag - CD BioSciences

service-banner

IL25 cDNA ORF Clone, Canine, C-Myc tag

IL25 cDNA ORF Clone, Canine, C-Myc tag

SPD-08128

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine interleukin 25 with C terminal Myc tag.
Target Information
Species Canine
Target Name IL-25
Gene Abbr. IL25
Gene ID 480252
Full Name interleukin 25
Introduction A number of cytokines belonging to the interleukin (IL)-17 family have been identified, termed IL-17A-F. IL-17 is a potent proinflammatory cytokine that plays roles in a number of diseases including rheumatoid arthritis, multiple sclerosis, and promotion of tumor growth. IL-17E, C, and B are able to induce proinflammatory responses. However, they do not bind to the IL-17 receptor suggesting that an additional IL-17R related receptor may exist. Receptors for IL-17B and IL-17E have been independently isolated by Shi, et al and Lee, et al. and have been designated as EV127 (in mouse) and IL-17Rh1 (in human), respectively. IL-17E, also called IL-25, induces activation of NF-kB pathway and like IL-17 also induces production of IL-8.
Product Details
Description Full length Clone DNA of Canine interleukin 25 with C terminal Myc tag.
NCBI Ref Seq XM_005623236.1
RefSeq ORF Size 510 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.