Il23r cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Il23r cDNA ORF Clone, Rat, untagged

Il23r cDNA ORF Clone, Rat, untagged

SPD-08095

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 23 receptor.
Target Information
Species Rat
Target Name IL-23 Receptor
Gene Abbr. Il23r
Gene ID 689932
Full Name interleukin 23 receptor
Introduction Interleukin 23 (IL-23) is a heterodimeric cytokine composed of two disulfide-linked subunits, a p19 subunit that is unique to IL-23, and a p40 subunit that is shared with IL-12. The functional IL-23 receptor complex consists of two receptor subunits, the IL-12 receptor beta 1 subunit (IL-12 R beta 1) and the IL-23-specific receptor subunit (IL-23 R).
Product Details
Description Full length Clone DNA of Rat interleukin 23 receptor.
NCBI Ref Seq XM_002726387.1
RefSeq ORF Size 1920 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.