Online Inquiry
IL23R cDNA ORF Clone, Human, N-HA tag
SPD-08114
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 23 receptor with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-23 Receptor |
Gene Abbr. | IL23R |
Gene ID | 149233 |
Full Name | interleukin 23 receptor |
Introduction | Interleukin 23 (IL-23) is a heterodimeric cytokine composed of two disulfide-linked subunits, a p19 subunit that is unique to IL-23, and a p40 subunit that is shared with IL-12. The functional IL-23 receptor complex consists of two receptor subunits, the IL-12 receptor beta 1 subunit (IL-12 R beta 1) and the IL-23-specific receptor subunit (IL-23 R). |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 23 receptor with N terminal HA tag. |
NCBI Ref Seq | BC040720 |
RefSeq ORF Size | 684 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + XbaI (6kb + 0.73kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.