Online Inquiry
IL23A cDNA ORF Clone, Rabbit, N-His tag
SPD-08072
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rabbit interleukin 23, alpha subunit p19-like with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Rabbit |
| Target Name | IL-23 |
| Gene Abbr. | IL23A |
| Gene ID | 100352065 |
| Full Name | interleukin 23 subunit alpha |
| Introduction | Interleukin 23 (IL-23) is a heterodimeric cytokine composed of two disulfide-linked subunits, a p19 subunit that is unique to IL-23, and a p40 subunit that is shared with IL-12. The p19 subunit has homology to the p35 subunit of IL-12, as well as to other single chain cytokines such as IL-6 and IL-11. The p40 subunit is homologous to the extracellular domains of the hematopoietic cytokine receptors. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rabbit interleukin 23, alpha subunit p19-like with N terminal His tag. |
| NCBI Ref Seq | XM_002711079.1 |
| RefSeq ORF Size | 576 bp |
| Vector | pCMV3-SP-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.