Il21r cDNA ORF Clone, Rat, N-FLAG tag - CD BioSciences

service-banner

Il21r cDNA ORF Clone, Rat, N-FLAG tag

Il21r cDNA ORF Clone, Rat, N-FLAG tag

SPD-08023

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 21 receptor with N terminal Flag tag.
Target Information
Species Rat
Target Name IL-21 Receptor
Gene Abbr. Il21r
Gene ID 308977
Full Name interleukin 21 receptor
Introduction Interleukin-21 (IL-21) and its receptor play an important role in the regulation of the immune system. IL-21 R, also called NILR (novel interleukin receptor), is a type I cytokine receptor with 4 conserved cysteine residues and an extracellular WSXWS motif. It is most closely related to IL-2 R beta, IL-4 R alpha and IL-9 R. The gene for human IL-21 R has been mapped to chromosome 16p12. Human IL-21 R is a 538 amino acid (aa) residue type I transmembrane protein with a 19 aa signal peptide, a 217 aa extracellular domain, a 19 aa transmembrane domain and a 283 aa cytoplasmic domain. IL-21 R is expressed on lymphoid tissues, peripheral B cells and cell lines of T, B and NK lineage. The common gamma chain ( gamma c) is required for IL-21 R signaling. The IL-21/IL-21 R interaction appears to play an important role in B and T cell proliferation after antigen stimulation and NK cell maturation.
Product Details
Description Full length Clone DNA of Rat interleukin 21 receptor with N terminal Flag tag.
NCBI Ref Seq NM_001012469.1
RefSeq ORF Size 1566 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.