Online Inquiry
Il21r cDNA ORF Clone, Rat, C-Myc tag
SPD-08020
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat interleukin 21 receptor with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | IL-21 Receptor |
| Gene Abbr. | Il21r |
| Gene ID | 308977 |
| Full Name | interleukin 21 receptor |
| Introduction | Interleukin-21 (IL-21) and its receptor play an important role in the regulation of the immune system. IL-21 R, also called NILR (novel interleukin receptor), is a type I cytokine receptor with 4 conserved cysteine residues and an extracellular WSXWS motif. It is most closely related to IL-2 R beta, IL-4 R alpha and IL-9 R. The gene for human IL-21 R has been mapped to chromosome 16p12. Human IL-21 R is a 538 amino acid (aa) residue type I transmembrane protein with a 19 aa signal peptide, a 217 aa extracellular domain, a 19 aa transmembrane domain and a 283 aa cytoplasmic domain. IL-21 R is expressed on lymphoid tissues, peripheral B cells and cell lines of T, B and NK lineage. The common gamma chain ( gamma c) is required for IL-21 R signaling. The IL-21/IL-21 R interaction appears to play an important role in B and T cell proliferation after antigen stimulation and NK cell maturation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat interleukin 21 receptor with C terminal Myc tag. |
| NCBI Ref Seq | NM_001012469.1 |
| RefSeq ORF Size | 1566 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.