Online Inquiry
Il21 cDNA ORF Clone, Mouse, C-HA tag
SPD-07981
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 21 with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-21 |
Gene Abbr. | Il21 |
Gene ID | 60505 |
Full Name | interleukin 21 |
Alias | IL-21 |
Introduction | Interleukin-21 (IL-21) and its receptor appear to play important roles in the regulation of the immune system. IL-21 is most related to IL-2, IL-4, and IL-15. IL-21 R, also called NILR (novel interleukin receptor), is a type I cytokine receptor with 4 conserved cysteine residues and an extracellular WSXWS motif. It is most closely related to IL-2 R beta and IL-4 R alpha. Mouse IL-21 is a 146 amino acid (aa) residue protein with a 24 aa signal peptide. Mouse and human IL-21 share 57% amino acid sequence identity. IL‑21 is expressed by activated T cells. Although not fully elucidated, the IL-2 R gamma ( gamma c) chain appears to play a role in IL-21 R signaling. The IL‑21/IL‑21 R interaction appear to play important roles in B and T cell proliferation after antigen stimulation and NK cell maturation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 21 with C terminal HA tag. |
NCBI Ref Seq | NM_021782.2 |
RefSeq ORF Size | 441 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.