IL21 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

IL21 cDNA ORF Clone, Human, N-His tag

IL21 cDNA ORF Clone, Human, N-His tag

SPD-08015

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 21 with N terminal His tag.
Target Information
Species Human
Target Name IL-21
Gene Abbr. IL21
Gene ID 59067
Full Name interleukin 21
Alias CVID11, IL-21, Za11
Introduction Interleukin-21 (IL-21) and its receptor appear to play important roles in the regulation of the immune system. IL-21 is most related to IL-2, IL-4, and IL-15. IL-21 R, also called NILR (novel interleukin receptor), is a type I cytokine receptor with 4 conserved cysteine residues and an extracellular WSXWS motif. It is most closely related to IL-2 R beta and IL-4 R alpha. Mouse IL-21 is a 146 amino acid (aa) residue protein with a 24 aa signal peptide. Mouse and human IL-21 share 57% amino acid sequence identity. IL‑21 is expressed by activated T cells. Although not fully elucidated, the IL-2 R gamma ( gamma c) chain appears to play a role in IL-21 R signaling. The IL‑21/IL‑21 R interaction appear to play important roles in B and T cell proliferation after antigen stimulation and NK cell maturation.
Product Details
Description Full length Clone DNA of Human interleukin 21 with N terminal His tag.
RefSeq ORF Size 495 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.