Il2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Il2 cDNA ORF Clone, Rat, untagged

Il2 cDNA ORF Clone, Rat, untagged

SPD-07779

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 2.
Target Information
Species Rat
Target Name IL-2
Gene Abbr. Il2
Gene ID 116562
Full Name interleukin 2
Introduction The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rat interleukin 2.
NCBI Ref Seq NM_053836.1
RefSeq ORF Size 468 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.