Online Inquiry
IL2 cDNA ORF Clone, Canine, N-Myc tag
SPD-07757
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine interleukin 2 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | IL-2 |
Gene Abbr. | IL2 |
Gene ID | 403989 |
Full Name | interleukin 2 |
Introduction | The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine interleukin 2 with N terminal Myc tag. |
NCBI Ref Seq | NM_001003305.1 |
RefSeq ORF Size | 468 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.