Online Inquiry
Il1rn cDNA ORF Clone, Mouse, untagged
SPD-07688
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse interleukin 1 receptor antagonist. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | IL1R Antagonist |
| Gene Abbr. | Il1rn |
| Gene ID | 16181 |
| Full Name | interleukin 1 receptor antagonist |
| Alias | F630041P17Rik, IL, IL-1ra |
| Introduction | The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse interleukin 1 receptor antagonist. |
| NCBI Ref Seq | NM_001039701.3 |
| RefSeq ORF Size | 537 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.