Il1rap cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Il1rap cDNA ORF Clone, Mouse, untagged

Il1rap cDNA ORF Clone, Mouse, untagged

SPD-07729

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 1 receptor accessory protein.
Target Information
Species Mouse
Target Name IL1RAP
Gene Abbr. Il1rap
Gene ID 16180
Full Name interleukin 1 receptor accessory protein
Alias 6430709H04Rik, AI255955, AV239853, IL-, IL-1RAcP
Introduction Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes an interleukin 1 receptor accessory protein. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse interleukin 1 receptor accessory protein.
NCBI Ref Seq NM_134103.2
RefSeq ORF Size 1083 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.08kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.