Online Inquiry
Il1rap cDNA ORF Clone, Mouse, N-His tag
SPD-07726
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 1 receptor accessory protein with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL1RAP |
Gene Abbr. | Il1rap |
Gene ID | 16180 |
Full Name | interleukin 1 receptor accessory protein |
Alias | 6430709H04Rik, AI255955, AV239853, IL-, IL-1RAcP |
Introduction | Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes an interleukin 1 receptor accessory protein. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 1 receptor accessory protein with N terminal His tag. |
NCBI Ref Seq | NM_134103.2 |
RefSeq ORF Size | 1083 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.