IL1RAP cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

IL1RAP cDNA ORF Clone, Human, C-Myc tag

IL1RAP cDNA ORF Clone, Human, C-Myc tag

SPD-07732

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 1 receptor accessory protein with C terminal Myc tag.
Target Information
Species Human
Target Name IL1RAP
Gene Abbr. IL1RAP
Gene ID 3556
Full Name interleukin 1 receptor accessory protein
Alias C3orf13, IL-1RAcP, IL1R3
Introduction Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes an interleukin 1 receptor accessory protein. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human interleukin 1 receptor accessory protein with C terminal Myc tag.
NCBI Ref Seq NM_002182.2
RefSeq ORF Size 1713 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.76kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.