Online Inquiry
Il1r1 cDNA ORF Clone, Rat, C-FLAG tag
SPD-06796
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 1 receptor, type I with C terminal Flag tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-1 Receptor |
Gene Abbr. | Il1r1 |
Gene ID | 25663 |
Full Name | interleukin 1 receptor type 1 |
Introduction | The Interleukin 1 receptor type I (IL-1R1) belongs to the IL-1 receptor family. IL-1R1 binds to IL-1 alpha, IL-1 beta, and interleukin-1 receptor antagonist protein (IL-1RA). IL-1RA regulates IL-1 ligand biological activity by a competitive interaction for IL-1R1. Upon IL-1 stimulation, adaptor molecule MyD88 is first recruited to the IL-1R1-IL1R accessory protein complex, followed by the recruitment of two serine-threonine kinases, IRAK4 and IRAK, and the adaptor protein TRAF6, resulting in activation of the NF-kB pathway. Stimulation of IL-1R1, leads to activation of the transcription factors NF-B, ATF, and AP-1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 1 receptor, type I with C terminal Flag tag. |
NCBI Ref Seq | NM_013123.3 |
RefSeq ORF Size | 1773 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.