Il1r1 cDNA ORF Clone, Rat, C-FLAG tag - CD BioSciences

service-banner

Il1r1 cDNA ORF Clone, Rat, C-FLAG tag

Il1r1 cDNA ORF Clone, Rat, C-FLAG tag

SPD-06796

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 1 receptor, type I with C terminal Flag tag.
Target Information
Species Rat
Target Name IL-1 Receptor
Gene Abbr. Il1r1
Gene ID 25663
Full Name interleukin 1 receptor type 1
Introduction The Interleukin 1 receptor type I (IL-1R1) belongs to the IL-1 receptor family. IL-1R1 binds to IL-1 alpha, IL-1 beta, and interleukin-1 receptor antagonist protein (IL-1RA). IL-1RA regulates IL-1 ligand biological activity by a competitive interaction for IL-1R1. Upon IL-1 stimulation, adaptor molecule MyD88 is first recruited to the IL-1R1-IL1R accessory protein complex, followed by the recruitment of two serine-threonine kinases, IRAK4 and IRAK, and the adaptor protein TRAF6, resulting in activation of the NF-kB pathway. Stimulation of IL-1R1, leads to activation of the transcription factors NF-B, ATF, and AP-1.
Product Details
Description Full length Clone DNA of Rat interleukin 1 receptor, type I with C terminal Flag tag.
NCBI Ref Seq NM_013123.3
RefSeq ORF Size 1773 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.