Il1b cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Il1b cDNA ORF Clone, Mouse, C-HA tag

Il1b cDNA ORF Clone, Mouse, C-HA tag

SPD-06759

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 1 beta with C terminal HA tag.
Target Information
Species Mouse
Target Name IL-1
Gene Abbr. Il1b
Gene ID 16176
Full Name interleukin 1 beta
Alias IL-, IL-1beta, Il-1b
Introduction IL-1 is a name that designates two proteins, IL-1 alpha and IL-1 beta, that are the products of distinct genes, but recognize the same cell surface receptors. IL-1 alpha and IL-1 beta are structurally related polypeptides that show approximately 25% homology at the amino acid level. Both proteins are produced by a wide variety of cells in response to stimuli such as those produced by inflammatory agents, infections, or microbial endotoxins. The proteins are synthesized as 31 kDa precursors that are subsequently cleaved into proteins with molecular weights of approximately 17.5 kDa. The specific protease responsible for the processing of IL-beta, designated interleukin 1 beta -converting enzyme (ICE), has been described. Mature human and mouse IL-1 beta share approximately 75% amino acid sequence identity and human IL-1 beta has been found to be active on murine cell lines.
Product Details
Description Full length Clone DNA of Mouse interleukin 1 beta with C terminal HA tag.
NCBI Ref Seq NM_008361.3
RefSeq ORF Size 810 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.