Online Inquiry
Il1a cDNA ORF Clone, Rat, untagged
SPD-06705
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 1 alpha. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-1 |
Gene Abbr. | Il1a |
Gene ID | 24493 |
Full Name | interleukin 1 alpha |
Alias | IL-1 alpha, IL-1F1 |
Introduction | IL-1 is a name that designates two proteins, IL-1 alpha and IL-1 beta, that are the products of distinct genes, but recognize the same cell surface receptors. IL-1 alpha and IL-1 beta are structurally related polypeptides that show approximately 25% homology at the amino acid level. Both proteins are produced by a wide variety of cells in response to stimuli such as those produced by inflammatory agents, infections, or microbial endotoxins. The proteins are synthesized as 31 kDa precursors that are subsequently cleaved into proteins with molecular weights of approximately 17.5 kDa. The specific protease responsible for the processing of IL-beta, designated interleukin 1 beta -converting enzyme (ICE), has been described. Mature human and mouse IL-1 beta share approximately 75% amino acid sequence identity and human IL-1 beta has been found to be active on murine cell lines. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 1 alpha. |
NCBI Ref Seq | NM_017019.1 |
RefSeq ORF Size | 813 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.