IL1A cDNA ORF Clone, Canine, N-FLAG tag - CD BioSciences

service-banner

IL1A cDNA ORF Clone, Canine, N-FLAG tag

IL1A cDNA ORF Clone, Canine, N-FLAG tag

SPD-06691

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine interleukin 1, alpha with N terminal Flag tag.
Target Information
Species Canine
Target Name IL-1
Gene Abbr. IL1A
Gene ID 403782
Full Name interleukin 1 alpha
Introduction IL-1 is a name that designates two proteins, IL-1 alpha and IL-1 beta, that are the products of distinct genes, but recognize the same cell surface receptors. IL-1 alpha and IL-1 beta are structurally related polypeptides that show approximately 25% homology at the amino acid level. Both proteins are produced by a wide variety of cells in response to stimuli such as those produced by inflammatory agents, infections, or microbial endotoxins. The proteins are synthesized as 31 kDa precursors that are subsequently cleaved into proteins with molecular weights of approximately 17.5 kDa. The specific protease responsible for the processing of IL-beta, designated interleukin 1 beta -converting enzyme (ICE), has been described. Mature human and mouse IL-1 beta share approximately 75% amino acid sequence identity and human IL-1 beta has been found to be active on murine cell lines.
Product Details
Description Full length Clone DNA of Canine interleukin 1, alpha with N terminal Flag tag.
NCBI Ref Seq NM_001003157.2
RefSeq ORF Size 798 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.