Online Inquiry
IL18RAP cDNA ORF Clone, Human, C-HA tag
SPD-07572
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 18 receptor accessory protein with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-18 Receptor |
Gene Abbr. | IL18RAP |
Gene ID | 8807 |
Full Name | interleukin 18 receptor accessory protein |
Alias | ACPL, CD218b, CDw218b, IL-18R-beta, IL-18RAcP |
Introduction | Interleukin 18 (IL-18) is a member of the IL-1 family of cytokines and shares numerous immunoregulatory functions with IL-12. The functional IL-18 receptor complex is composed of two subunits designated IL-18 R alpha (also termed IL-1 R5 and IL-1 Rrp) and IL-18 R beta (also termed IL-1 R7 and AcPL). Both IL-18 R alpha and IL-18 R beta belong to the IL-1 receptor superfamily. Although IL-18 R by itself binds IL-18 with low affinity and IL-18 R beta does not bind IL-18 in vitro, co-expression of IL‑18 R alpha and IL‑18 R beta is required for high affinity binding and IL-18 responsiveness. Human IL-18 R cDNA encodes a 541 amino acid (aa) precursor type I membrane protein with a hydrophobic signal, an extracellular domain comprised of three immunoglobulin-like domains, a transmembrane domain and a cytoplasmic region of approximately 200 aa. Human and mouse IL-18 R share 65% amino acid sequence homology. IL-18 R is widely expressed in numerous tissues including spleen, thymus, leukocyte, liver, lung, heart, small and large intestine, prostate and placenta. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 18 receptor accessory protein with C terminal HA tag. |
NCBI Ref Seq | NM_003853.2 |
RefSeq ORF Size | 1800 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.