IL18R1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL18R1 cDNA ORF Clone, Human, untagged

IL18R1 cDNA ORF Clone, Human, untagged

SPD-07548

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 18 receptor 1.
Target Information
Species Human
Target Name IL-18 Receptor
Gene Abbr. IL18R1
Gene ID 8809
Full Name interleukin 18 receptor 1
Alias CD218a, CDw218a, IL-18R-alpha, IL-18Ralpha, IL-1Rrp
Introduction Interleukin 18 (IL-18) is a member of the IL-1 family of cytokines and shares numerous immunoregulatory functions with IL-12. The functional IL-18 receptor complex is composed of two subunits designated IL-18 R alpha (also termed IL-1 R5 and IL-1 Rrp) and IL-18 R beta (also termed IL-1 R7 and AcPL). Both IL-18 R alpha and IL-18 R beta belong to the IL-1 receptor superfamily. Although IL-18 R by itself binds IL-18 with low affinity and IL-18 R beta does not bind IL-18 in vitro, co-expression of IL‑18 R alpha and IL‑18 R beta is required for high affinity binding and IL-18 responsiveness. Human IL-18 R cDNA encodes a 541 amino acid (aa) precursor type I membrane protein with a hydrophobic signal, an extracellular domain comprised of three immunoglobulin-like domains, a transmembrane domain and a cytoplasmic region of approximately 200 aa. Human and mouse IL-18 R share 65% amino acid sequence homology. IL-18 R is widely expressed in numerous tissues including spleen, thymus, leukocyte, liver, lung, heart, small and large intestine, prostate and placenta.
Product Details
Description Full length Clone DNA of Human interleukin 18 receptor 1.
NCBI Ref Seq NM_003855.2
RefSeq ORF Size 1626 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.63kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.