Il18 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Il18 cDNA ORF Clone, Mouse, C-FLAG tag

Il18 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-07609

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 18 with C terminal Flag tag.
Target Information
Species Mouse
Target Name IL-18/IL-1F4
Gene Abbr. Il18
Gene ID 16173
Full Name interleukin 18
Alias Ig, Igif, Il-, Il-18
Introduction Interleukin 18 (IL-18) is a 18 kDa cytokine which identified as a costimulatory factor for production of interferon-gamma (IFN-gamma ) in response to toxic shock and shares functional similarities with IL-12. IL-18 is synthesized as a precursor 24 kDa molecule without a signal peptide and must be cleaved to produce an active molecule. IL-1 converting enzyme (ICE, Caspase-1) cleaves pro-IL-18 at aspartic acid in the P1 position, producing the mature, bioactive peptide that is readily released from the cells. It is reported that IL-18 is produced from Kupffer cells, activated macrophages, keratinocytes, intestinal epithelial cells, osteoblasts, adrenal cortex cells and murine diencephalon. IFN-gamma is produced by activated T or NK cells and plays critical roles in the defense against microbiral pathogens. IFN-gamma activates macrophages, enhances NK activity and B cell maturation, proliferation and Ig secretion, induces MHC class I and II antigens, and inhibits osteoclast activation. IL-18 acts on T helper type-1 (Th1) T cells and in combination with IL-12 strongly induces them to produce IFN-gamma. Pleiotropic effects of IL-18 has also been reported, such as, enhancement production of IFN-gamma and GM-CSF in peripheral blood mononuclear cells, production of Th1 cytokines, IL-2, GM-CSF and IFN-gamma in T cells, enhancement of Fas ligand expression by Th1 cells.
Product Details
Description Full length Clone DNA of Mouse interleukin 18 with C terminal Flag tag.
NCBI Ref Seq NM_008360.1
RefSeq ORF Size 579 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.63kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.