Online Inquiry
IL18 cDNA ORF Clone, Canine, C-HA tag
SPD-07592
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine interleukin 18 (interferon-gamma-inducing factor) with C terminal HA tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | IL-18/IL-1F4 |
Gene Abbr. | IL18 |
Gene ID | 403796 |
Full Name | interleukin 18 |
Introduction | Interleukin 18 (IL-18) is a 18 kDa cytokine which identified as a costimulatory factor for production of interferon-gamma (IFN-gamma ) in response to toxic shock and shares functional similarities with IL-12. IL-18 is synthesized as a precursor 24 kDa molecule without a signal peptide and must be cleaved to produce an active molecule. IL-1 converting enzyme (ICE, Caspase-1) cleaves pro-IL-18 at aspartic acid in the P1 position, producing the mature, bioactive peptide that is readily released from the cells. It is reported that IL-18 is produced from Kupffer cells, activated macrophages, keratinocytes, intestinal epithelial cells, osteoblasts, adrenal cortex cells and murine diencephalon. IFN-gamma is produced by activated T or NK cells and plays critical roles in the defense against microbiral pathogens. IFN-gamma activates macrophages, enhances NK activity and B cell maturation, proliferation and Ig secretion, induces MHC class I and II antigens, and inhibits osteoclast activation. IL-18 acts on T helper type-1 (Th1) T cells and in combination with IL-12 strongly induces them to produce IFN-gamma. Pleiotropic effects of IL-18 has also been reported, such as, enhancement production of IFN-gamma and GM-CSF in peripheral blood mononuclear cells, production of Th1 cytokines, IL-2, GM-CSF and IFN-gamma in T cells, enhancement of Fas ligand expression by Th1 cells. |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine interleukin 18 (interferon-gamma-inducing factor) with C terminal HA tag. |
NCBI Ref Seq | NM_001003169.1 |
RefSeq ORF Size | 582 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.