Online Inquiry
Il17rb cDNA ORF Clone, Mouse, N-Myc tag
SPD-07444
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse interleukin 17 receptor B with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | IL-17 Receptor |
| Gene Abbr. | Il17rb |
| Gene ID | 50905 |
| Full Name | interleukin 17 receptor B |
| Alias | Evi, Evi27, IL-1, IL-17, IL-17ER |
| Introduction | The interleukin 17 (IL-17) family of cytokines, comprising six members (IL-17, IL-17B through IL-17F), are structurally related proteins with a conserved cysteine-knot structure. These proinflammatory cytokines can induce local cytokine productions and are involved in the regulation of the immune response. The cognate receptors activated by some of these cytokines have been identified. Interleukin-17 B Receptor (IL-17 RB), also known as IL-17Rh1, IL-17ER and EVI27, represents the second receptor of the IL-17 family of cytokines to be recognized. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse interleukin 17 receptor B with N terminal Myc tag. |
| NCBI Ref Seq | NM_019583.3 |
| RefSeq ORF Size | 1500 bp |
| Vector | pCMV3-SP-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.