Il17rb cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Il17rb cDNA ORF Clone, Mouse, N-Myc tag

Il17rb cDNA ORF Clone, Mouse, N-Myc tag

SPD-07444

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 17 receptor B with N terminal Myc tag.
Target Information
Species Mouse
Target Name IL-17 Receptor
Gene Abbr. Il17rb
Gene ID 50905
Full Name interleukin 17 receptor B
Alias Evi, Evi27, IL-1, IL-17, IL-17ER
Introduction The interleukin 17 (IL-17) family of cytokines, comprising six members (IL-17, IL-17B through IL-17F), are structurally related proteins with a conserved cysteine-knot structure. These proinflammatory cytokines can induce local cytokine productions and are involved in the regulation of the immune response. The cognate receptors activated by some of these cytokines have been identified. Interleukin-17 B Receptor (IL-17 RB), also known as IL-17Rh1, IL-17ER and EVI27, represents the second receptor of the IL-17 family of cytokines to be recognized.
Product Details
Description Full length Clone DNA of Mouse interleukin 17 receptor B with N terminal Myc tag.
NCBI Ref Seq NM_019583.3
RefSeq ORF Size 1500 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.