Online Inquiry
Il17ra cDNA ORF Clone, Rat, C-HA tag
SPD-07400
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 17 receptor A with C terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-17 Receptor |
Gene Abbr. | Il17ra |
Gene ID | 312679 |
Full Name | interleukin 17 receptor A |
Alias | Il17r |
Introduction | IL-17 R, also known as IL-17 RA, is a 120 kDa type I transmembrane glycoprotein protein that plays a central role in inflammatory responses. Mature mouseIL‑17 R consists of a 291 amino acid (aa) extracellular domain, a 21 aa transmembrane segment, and a 521 aa cytoplasmic domain. The cytoplasmic domain contains a region homologous to the TIR domain of the TLR/IL-1 R family. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 17 receptor A with C terminal HA tag. |
NCBI Ref Seq | NM_001107883.2 |
RefSeq ORF Size | 2607 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.