Online Inquiry
IL17F cDNA ORF Clone, Cynomolgus, C-His tag
SPD-07392
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Cynomolgus interleukin 17F with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Cynomolgus |
| Target Name | IL-17 |
| Gene Abbr. | IL17F |
| Gene ID | 102118959 |
| Full Name | interleukin 17F |
| Introduction | The Interleukin 17 (IL-17) family proteins, comprising six members (IL-17, IL-17B through IL-17F), are secreted, structurally related proteins that share a conserved cystine-knot fold near the C-terminus, but have considerable sequence divergence at the N-terminus. With the exception of IL-17B, which exists as a non‑covalently linked dimer, all IL-17 family members are disulfide-linked dimers. IL-17 family proteins are pro‑inflammatory cytokines that induce local cytokine production and are involved in the regulation of immune functions. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Cynomolgus interleukin 17F with C terminal His tag. |
| NCBI Ref Seq | XM_015449324.1 |
| RefSeq ORF Size | 537 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 0.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.