IL17D cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL17D cDNA ORF Clone, Human, untagged

IL17D cDNA ORF Clone, Human, untagged

SPD-07360

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 17D.
Target Information
Species Human
Target Name IL-17
Gene Abbr. IL17D
Gene ID 53342
Full Name interleukin 17D
Alias IL-17D
Product Details
Description Full length Clone DNA of Human interleukin 17D.
NCBI Ref Seq NM_138284.1
RefSeq ORF Size 609 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (pCMV3-untagged-HindIII-XbaI)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.