IL17C cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL17C cDNA ORF Clone, Human, untagged

IL17C cDNA ORF Clone, Human, untagged

SPD-07350

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 17C.
Target Information
Species Human
Target Name IL-17
Gene Abbr. IL17C
Gene ID 27189
Full Name interleukin 17C
Alias CX2, IL-17C
Introduction The Interleukin 17 (IL-17) family proteins, comprising six members (IL-17, IL-17B through IL-17F), are secreted, structurally related proteins that share a conserved cystine-knot fold near the C-terminus, but have considerable sequence divergence at the N-terminus. With the exception of IL-17B, which exists as a non‑covalently linked dimer, all IL-17 family members are disulfide-linked dimers. IL-17 family proteins are pro‑inflammatory cytokines that induce local cytokine production and are involved in the regulation of immune functions.
Product Details
Description Full length Clone DNA of Human interleukin 17C.
NCBI Ref Seq NM_013278.3
RefSeq ORF Size 594 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 0.59kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.