IL17A cDNA ORF Clone, Marmoset, N-HA tag - CD BioSciences

service-banner

IL17A cDNA ORF Clone, Marmoset, N-HA tag

IL17A cDNA ORF Clone, Marmoset, N-HA tag

SPD-07288

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Marmoset interleukin 17A with N terminal HA tag.
Target Information
Species Marmoset
Target Name IL-17
Gene Abbr. IL17A
Gene ID 100385200
Full Name interleukin 17A
Introduction Interleukin 17 (also known as CTLA-8) is a T cell-expressed pleiotropic cytokine that exhibits a high degree of homology to a protein encoded by the ORF13 gene of herpesvirus Saimiri. cDNA clones encoding IL-17 have been isolated from activated rat, mouse, and human T cells. Mouse IL-17 cDNA encodes a 158 amino acid (aa) residue precursor protein with a 21 amino acid residue signal peptide that is cleaved to yield the 137 aa residue mature IL-17. Both recombinant and natural IL-17 have been shown to exist as disulfide linked homodimers. At the amino acid level, mIL-17 shows 57% and 87% sequence identity with herpesvirus and rat IL-17, respectively. An IL-17 specific mouse cell surface receptor (IL-17 R) has been cloned. While the expression of IL-17 mRNA is restricted to activated alpha beta TCR+CD4-CD8-T cells, the expression of mIL-17 R mRNA has been detected in virtually all cells and tissues tested. IL-17 exhibits multiple biological activities on a variety of cells including: the induction of IL-6 and IL-8 production in fibroblasts; the enhancement of surface expression of ICAM-1 in fibroblasts; activation of NF-kappa B and costimulation of T cell proliferation.
Product Details
Description Full length Clone DNA of Marmoset interleukin 17A with N terminal HA tag.
NCBI Ref Seq EF534212.1
RefSeq ORF Size 462 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.