Online Inquiry
IL17A cDNA ORF Clone, Human, C-FLAG tag
SPD-07300
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 17A with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-17 |
Gene Abbr. | IL17A |
Gene ID | 3605 |
Full Name | interleukin 17A |
Alias | CTLA-8, CTLA8, IL-17, IL-17A, IL17 |
Introduction | Interleukin 17 (also known as CTLA-8) is a T cell-expressed pleiotropic cytokine that exhibits a high degree of homology to a protein encoded by the ORF13 gene of herpesvirus Saimiri. cDNA clones encoding IL-17 have been isolated from activated rat, mouse, and human T cells. Mouse IL-17 cDNA encodes a 158 amino acid (aa) residue precursor protein with a 21 amino acid residue signal peptide that is cleaved to yield the 137 aa residue mature IL-17. Both recombinant and natural IL-17 have been shown to exist as disulfide linked homodimers. At the amino acid level, mIL-17 shows 57% and 87% sequence identity with herpesvirus and rat IL-17, respectively. An IL-17 specific mouse cell surface receptor (IL-17 R) has been cloned. While the expression of IL-17 mRNA is restricted to activated alpha beta TCR+CD4-CD8-T cells, the expression of mIL-17 R mRNA has been detected in virtually all cells and tissues tested. IL-17 exhibits multiple biological activities on a variety of cells including: the induction of IL-6 and IL-8 production in fibroblasts; the enhancement of surface expression of ICAM-1 in fibroblasts; activation of NF-kappa B and costimulation of T cell proliferation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 17A with C terminal Flag tag. |
NCBI Ref Seq | NM_002190 |
RefSeq ORF Size | 468 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.51kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.