Il15ra cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Il15ra cDNA ORF Clone, Mouse, C-HA tag

Il15ra cDNA ORF Clone, Mouse, C-HA tag

SPD-07231

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 15 receptor,alphachain with C terminal HA tag.
Target Information
Species Mouse
Target Name IL-15 Receptor
Gene Abbr. Il15ra
Gene ID 16169
Full Name interleukin 15 receptor, alpha chain
Alias AA690181, IL-15RA
Introduction Interleukin 15 receptor alpha (IL-15 R alpha ) is a high affinity receptor that specifically binds IL-15 with high affinity and associates as a heterotrimer with the IL-2 receptors beta and gamma subunits to initiate signal transduction. IL-15 R alpha is expressed on a wide variety of T cells and B cells as well as non-lymphoid cells. IL‑15 R alpha is a 58-60 kDa protein that shares structural similarities to the IL-2 R alpha protein. IL-15 R alpha and IL-2 R alpha genes also share similar intron-exon organization and are closely linked on human chromosome 10p14-p15. Human IL-15 R alpha shares 45% amino acid (aa) homology with the mouse form of the receptor. Signaling of IL-15 can occur in one of three ways; through the heterotrimeric complex of IL-15 R alpha, IL-2 R beta, and IL-2 R gamma c, through the heterodimeric complex of IL-2 receptors beta and gamma common, through a novel 60-65 kDa IL-15 RX subunit found on mast cells. The binding of IL-15 to IL-15 R alpha has been reported to antagonize the TNF-alpha -mediated apoptosis in fibroblasts by competing with TNF RI for TRAF2 binding.
Product Details
Description Full length Clone DNA of Mouse interleukin 15 receptor,alphachain with C terminal HA tag.
NCBI Ref Seq NM_008358.1
RefSeq ORF Size 792 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.