Online Inquiry
IL15RA cDNA ORF Clone, Human, C-HA tag
SPD-07241
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human interleukin 15 receptor, alpha with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | IL-15 Receptor |
| Gene Abbr. | IL15RA |
| Gene ID | 3601 |
| Full Name | interleukin 15 receptor subunit alpha |
| Alias | CD215 |
| Introduction | Interleukin 15 receptor alpha (IL-15 R alpha ) is a high affinity receptor that specifically binds IL-15 with high affinity and associates as a heterotrimer with the IL-2 receptors beta and gamma subunits to initiate signal transduction. IL-15 R alpha is expressed on a wide variety of T cells and B cells as well as non-lymphoid cells. IL‑15 R alpha is a 58-60 kDa protein that shares structural similarities to the IL-2 R alpha protein. IL-15 R alpha and IL-2 R alpha genes also share similar intron-exon organization and are closely linked on human chromosome 10p14-p15. Human IL-15 R alpha shares 45% amino acid (aa) homology with the mouse form of the receptor. Signaling of IL-15 can occur in one of three ways; through the heterotrimeric complex of IL-15 R alpha, IL-2 R beta, and IL-2 R gamma c, through the heterodimeric complex of IL-2 receptors beta and gamma common, through a novel 60-65 kDa IL-15 RX subunit found on mast cells. The binding of IL-15 to IL-15 R alpha has been reported to antagonize the TNF-alpha -mediated apoptosis in fibroblasts by competing with TNF RI for TRAF2 binding. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human interleukin 15 receptor, alpha with C terminal HA tag. |
| NCBI Ref Seq | NM_001243539.1 |
| RefSeq ORF Size | 738 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 0.74kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.