IL15 cDNA ORF Clone, Rhesus, N-Myc tag - CD BioSciences

service-banner

IL15 cDNA ORF Clone, Rhesus, N-Myc tag

IL15 cDNA ORF Clone, Rhesus, N-Myc tag

SPD-07195

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus interleukin 15 with N terminal Myc tag.
Target Information
Species Rhesus
Target Name IL-15
Gene Abbr. IL15
Gene ID 699616
Full Name interleukin 15
Introduction Interleukin 15 (IL-15) is a widely expressed 14 kDa cytokine that is structurally and functionally related to IL-2. The dominant mechanism of IL-15 action is known as transpresentation in which IL-15 and IL-15 R alpha are coordinately expressed on the surface of one cell and interact with complexes of IL-2 R beta/gamma c on adjacent cells. This enables cells to respond to IL-15 even if they do not express IL-15 R alpha. Soluble IL-15-binding forms of IL-15 R alpha can be generated by proteolytic shedding or alternate splicing.
Product Details
Description Full length Clone DNA of Rhesus interleukin 15 with N terminal Myc tag.
NCBI Ref Seq NM_001044731.1
RefSeq ORF Size 489 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.