Online Inquiry
Il15 cDNA ORF Clone, Rat, N-Myc tag
SPD-07205
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 15 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-15 |
Gene Abbr. | Il15 |
Gene ID | 25670 |
Full Name | interleukin 15 |
Introduction | Interleukin 15 (IL-15) is a widely expressed 14 kDa cytokine that is structurally and functionally related to IL-2. The dominant mechanism of IL-15 action is known as transpresentation in which IL-15 and IL-15 R alpha are coordinately expressed on the surface of one cell and interact with complexes of IL-2 R beta/gamma c on adjacent cells. This enables cells to respond to IL-15 even if they do not express IL-15 R alpha. Soluble IL-15-binding forms of IL-15 R alpha can be generated by proteolytic shedding or alternate splicing. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 15 with N terminal Myc tag. |
NCBI Ref Seq | NM_013129.2 |
RefSeq ORF Size | 489 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.