Il13ra1 cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Il13ra1 cDNA ORF Clone, Rat, N-Myc tag

Il13ra1 cDNA ORF Clone, Rat, N-Myc tag

SPD-07164

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 13 receptor, alpha 1 with N terminal Myc tag.
Target Information
Species Rat
Target Name IL-13 Receptor
Gene Abbr. Il13ra1
Gene ID 252963
Full Name interleukin 13 receptor subunit alpha 1
Introduction Two type 1 membrane proteins belonging to the hemopoietin receptor family have been cloned and shown to bind IL-13 with differing affinities. The lower affinity IL-13 binding protein, previously designated IL-13 R alpha, IL-13 R alpha ' or NR4, is now referred to as IL-13 R alpha 1. The high-affinity IL-13 binding protein, previously also designated IL-13 R or IL-13 R alpha ', is now referred to as IL-13 R alpha 2. The human IL-13 R alpha 1 was originally cloned based on sequence homology to the mouse IL-13 R alpha 1. The IL‑13 R alpha 1 cDNA encodes a 427 amino acid (aa) residue precursor protein with a putative 21 aa residue signal peptide, a 324 aa residue extracellular domain, a 23 aa residue transmembrane region and a 59 aa residue cytoplasmic tail. Human and mouse IL-13 R alpha 1 share 76% aa sequence identity. The extracellular domain of IL‑13 R alpha 1 is also closely related to that of IL-13 R alpha 2. IL-13 R alpha 1 has been shown to combine with the IL-4 R alpha to form a high-affinity receptor complex capable of transducing an IL-13-dependent proliferative signal. The role of IL-13 R alpha 2 in IL-13 signaling remains to be elucidated.
Product Details
Description Full length Clone DNA of Rat interleukin 13 receptor, alpha 1 with N terminal Myc tag.
NCBI Ref Seq NM_145789.2
RefSeq ORF Size 1281 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.