Online Inquiry
Il13ra1 cDNA ORF Clone, Rat, N-His tag
SPD-07163
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 13 receptor, alpha 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-13 Receptor |
Gene Abbr. | Il13ra1 |
Gene ID | 252963 |
Full Name | interleukin 13 receptor subunit alpha 1 |
Introduction | Two type 1 membrane proteins belonging to the hemopoietin receptor family have been cloned and shown to bind IL-13 with differing affinities. The lower affinity IL-13 binding protein, previously designated IL-13 R alpha, IL-13 R alpha ' or NR4, is now referred to as IL-13 R alpha 1. The high-affinity IL-13 binding protein, previously also designated IL-13 R or IL-13 R alpha ', is now referred to as IL-13 R alpha 2. The human IL-13 R alpha 1 was originally cloned based on sequence homology to the mouse IL-13 R alpha 1. The IL‑13 R alpha 1 cDNA encodes a 427 amino acid (aa) residue precursor protein with a putative 21 aa residue signal peptide, a 324 aa residue extracellular domain, a 23 aa residue transmembrane region and a 59 aa residue cytoplasmic tail. Human and mouse IL-13 R alpha 1 share 76% aa sequence identity. The extracellular domain of IL‑13 R alpha 1 is also closely related to that of IL-13 R alpha 2. IL-13 R alpha 1 has been shown to combine with the IL-4 R alpha to form a high-affinity receptor complex capable of transducing an IL-13-dependent proliferative signal. The role of IL-13 R alpha 2 in IL-13 signaling remains to be elucidated. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 13 receptor, alpha 1 with N terminal His tag. |
NCBI Ref Seq | NM_145789.2 |
RefSeq ORF Size | 1281 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.