Il12b cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Il12b cDNA ORF Clone, Rat, N-HA tag

Il12b cDNA ORF Clone, Rat, N-HA tag

SPD-07054

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 12b with N terminal HA tag.
Target Information
Species Rat
Target Name IL-12
Gene Abbr. Il12b
Gene ID 64546
Full Name interleukin 12B
Alias Il12
Introduction Interleukin 12, also known as Natural Killer Cell Stimulatory Factor (NKSF) or Cytotoxic Lymphocyte Maturation Factor (CLMF), is a heterodimeric pleiotropic cytokine made up of a 40 kDa (p40) subunit and a 35 kDa (p35) subunit. IL‑12 is produced by macrophages and B lymphocytes and has been shown to have multiple effects on T cells and Natural Killer (NK) cells. Some of these IL‑12 activities include the induction of IFN‑ gamma and TNF in resting and activated T and NK cells; the enhancement of cytotoxic activity of resting NK and T cells, the stimulation of resting T cell proliferation in the presence of a comitogen; and the enhancement of NK cell proliferation. IL‑12 is a key mediator of cellular-immunity and induces the differentiation of Th1 cells from precursor T helper cells. Based on its activities, it has been suggested that IL‑12 may have therapeutic potential as a vaccine adjuvant that promotes cellular-immunity and as an anti-tumor and anti-viral agent. Human and mouse IL‑12 share 70% and 60% amino acid sequence identity in their p40 and p35 subunits, respectively.
Product Details
Description Full length Clone DNA of Rat interleukin 12b with N terminal HA tag.
NCBI Ref Seq NM_022611.1
RefSeq ORF Size 1008 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.