Online Inquiry
IL12B cDNA ORF Clone, Marmoset, N-FLAG tag
SPD-07081
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Marmoset interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Marmoset |
Target Name | IL-12 |
Gene Abbr. | IL12B |
Gene ID | 100395403 |
Full Name | interleukin 12B |
Alias | IL-12B |
Introduction | Interleukin 12, also known as Natural Killer Cell Stimulatory Factor (NKSF) or Cytotoxic Lymphocyte Maturation Factor (CLMF), is a heterodimeric pleiotropic cytokine made up of a 40 kDa (p40) subunit and a 35 kDa (p35) subunit. IL‑12 is produced by macrophages and B lymphocytes and has been shown to have multiple effects on T cells and Natural Killer (NK) cells. Some of these IL‑12 activities include the induction of IFN‑ gamma and TNF in resting and activated T and NK cells; the enhancement of cytotoxic activity of resting NK and T cells, the stimulation of resting T cell proliferation in the presence of a comitogen; and the enhancement of NK cell proliferation. IL‑12 is a key mediator of cellular-immunity and induces the differentiation of Th1 cells from precursor T helper cells. Based on its activities, it has been suggested that IL‑12 may have therapeutic potential as a vaccine adjuvant that promotes cellular-immunity and as an anti-tumor and anti-viral agent. Human and mouse IL‑12 share 70% and 60% amino acid sequence identity in their p40 and p35 subunits, respectively. |
Product Details | |
---|---|
Description | Full length Clone DNA of Marmoset interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) with N terminal Flag tag. |
NCBI Ref Seq | XM_002744108.2 |
RefSeq ORF Size | 987 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.