Il12a cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Il12a cDNA ORF Clone, Mouse, N-His tag

Il12a cDNA ORF Clone, Mouse, N-His tag

SPD-07012

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 12a with N terminal His tag.
Target Information
Species Mouse
Target Name IL-12
Gene Abbr. Il12a
Gene ID 16159
Full Name interleukin 12a
Alias IL-12, IL-12p35, Il-12a, Ll12a, p3
Introduction Interleukin 12, also known as Natural Killer Cell Stimulatory Factor (NKSF) or Cytotoxic Lymphocyte Maturation Factor (CLMF), is a heterodimeric pleiotropic cytokine made up of a 40 kDa (p40) subunit and a 35 kDa (p35) subunit. IL‑12 is produced by macrophages and B lymphocytes and has been shown to have multiple effects on T cells and Natural Killer (NK) cells. Some of these IL‑12 activities include the induction of IFN‑ gamma and TNF in resting and activated T and NK cells; the enhancement of cytotoxic activity of resting NK and T cells, the stimulation of resting T cell proliferation in the presence of a comitogen; and the enhancement of NK cell proliferation. IL‑12 is a key mediator of cellular-immunity and induces the differentiation of Th1 cells from precursor T helper cells. Based on its activities, it has been suggested that IL‑12 may have therapeutic potential as a vaccine adjuvant that promotes cellular-immunity and as an anti-tumor and anti-viral agent. Human and mouse IL‑12 share 70% and 60% amino acid sequence identity in their p40 and p35 subunits, respectively.
Product Details
Description Full length Clone DNA of Mouse interleukin 12a with N terminal His tag.
NCBI Ref Seq NM_008351.2
RefSeq ORF Size 648 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.